| Accession | MI0016689 | ||||
| Name | hsa-mir-548aa-1 | ||||
| similar to following miRCarta precursors | hsa-650.2 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr8:123,348,034-123,348,130 (+) |
||||
| miRNA | hsa-miR-548aa | ||||
| Sequence (5' -> 3') (97 nts) |
CUUUAUUAGUCUGGUGCAAAAGAAACUGUGGUUUUUGCCAUUACUUUUACAGGCAAAAACCACAAUUACUUUUGCACCAACCUAAUAUAACUUGUUU | ||||
| MFE | -42.20 kcal/mol | ||||
| first miRBase version | 16.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-548d-1
hsa-mir-548aa-1 |
||||
| Family | mir-548 (MIPF0000317) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Witten et al. | BMC Biol. | 2010 | 20459774 | Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls. |