| Accession | MI0016620 | ||||||
| Name | ssc-mir-149 | ||||||
| similar to following miRCarta precursors | ssc-195.1 | ||||||
| Organism | Sus scrofa | ||||||
| Genome | Sscrofa10.2 | ||||||
| Location |
chr15:154,447,027-154,447,102 (-) |
||||||
| miRNA | ssc-miR-149 | ||||||
| Sequence (5' -> 3') (76 nts) |
GCCCAGGCUCUGGCUCCGUGUCUUCACUCCCGUGUGUGUCCGAGGAGGGAGGGAGGGACGGGGGCUGUGCUGGGGC | ||||||
| MFE | -38.10 kcal/mol | ||||||
| first miRBase version | 16.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (1 precursors) |
ssc-mir-149 |
||||||
| Family | mir-149 (MIPF0000274) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Cho et al. | Mol. Biol. Rep. | 2010 | 20180025 | Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue. |
| 2 | Li et al. | J. Cell. Biochem. | 2011 | 21312241 | MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing. |
| 3 | Chen et al. | BMC Genomics | 2014 | 24499489 | Exploration of microRNAs in porcine milk exosomes. |