| Accession | MI0016068 | ||||
| Name | hsa-mir-3667 | ||||
| similar to following miRCarta precursors | hsa-1357-1550.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr22:49,543,393-49,543,466 (-) |
||||
| miRNA | hsa-miR-3667-5p | ||||
| miRNA | hsa-miR-3667-3p | ||||
| Sequence (5' -> 3') (74 nts) |
UGAGGAUGAAAGACCCAUUGAGGAGAAGGUUCUGCUGGCUGAGAACCUUCCUCUCCAUGGGUCUUUCAUCCUCA | ||||
| MFE | -51.60 kcal/mol | ||||
| first miRBase version | 16.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-3667 |
||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Vaz et al. | BMC Genomics | 2010 | 20459673 | Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood. |