| Accession | MI0016062 | ||||||
| Name | hsa-mir-3661 | ||||||
| similar to following miRCarta precursors | hsa-1067.1 | ||||||
| Organism | Homo sapiens | ||||||
| Genome | GRCh38.p10 | ||||||
| Location |
chr5:134,225,757-134,225,852 (+) |
||||||
| miRNA | hsa-miR-3661 | ||||||
| Sequence (5' -> 3') (96 nts) |
CACCUUCUCGCAGAGGCUCUUGACCUGGGACUCGGACAGCUGCUUGCACUCGUUCAGCUGCUCGAUCCACUGGUCCAGCUCCUUGGUGAACACCUU | ||||||
| MFE | -33.50 kcal/mol | ||||||
| first miRBase version | 16.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-3661 |
||||||
| Family | mir-3661 (MIPF0001530) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Hansen et al. | PLoS ONE | 2010 | 20532037 | Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes. |
| 2 | Persson et al. | Cancer Res. | 2011 | 21199797 | Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. |