| Accession | MI0015996 | ||||
| Name | hsa-mir-3606 | ||||
| similar to following miRCarta precursors | hsa-2109-2447.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr2:188,995,630-188,995,692 (+) |
||||
| miRNA | hsa-miR-3606-5p | ||||
| miRNA | hsa-miR-3606-3p | ||||
| Sequence (5' -> 3') (63 nts) |
UUGUUGCUAUCUAGGUUAGUGAAGGCUAUUUUAAUUUUUUUAAAAUUUCUUUCACUACUUAGG | ||||
| MFE | -20.10 kcal/mol | ||||
| first miRBase version | 16.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-3606 |
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Witten et al. | BMC Biol. | 2010 | 20459774 | Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls. |