| Accession | MI0015909 | ||||||
| Name | ssc-mir-133a-2 | ||||||
| similar to following miRCarta precursors | ssc-902-26270.1 | ||||||
| Organism | Sus scrofa | ||||||
| Genome | Sscrofa10.2 | ||||||
| Location |
chr6:99,485,213-99,485,285 (+) |
||||||
| miRNA | ssc-miR-133a-5p | ||||||
| miRNA | ssc-miR-133a-3p | ||||||
| Sequence (5' -> 3') (73 nts) |
UAGAGCUGGUAAAAUGGAACCAAAUCGCCUCUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCAU | ||||||
| MFE | -25.60 kcal/mol | ||||||
| first miRBase version | 16.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (1 precursors) |
ssc-mir-133a-2 |
||||||
| Family | mir-133 (MIPF0000029) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Reddy et al. | BMC Genomics | 2009 | 19196471 | Cloning, characterization and expression analysis of porcine microRNAs. |
| 2 | Sharbati et al. | BMC Genomics | 2010 | 20433717 | Deciphering the porcine intestinal microRNA transcriptome. |
| 3 | Cho et al. | Mol. Biol. Rep. | 2010 | 20180025 | Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue. |
| 4 | Nielsen et al. | Anim. Genet. | 2010 | 19917043 | MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing. |
| 5 | Chen et al. | BMC Genomics | 2014 | 24499489 | Exploration of microRNAs in porcine milk exosomes. |