| Accession | MI0015854 | ||||
| Name | hsa-mir-4324 | ||||
| similar to following miRCarta precursors | hsa-1196.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr19:49,308,797-49,308,868 (-) |
||||
| miRNA | hsa-miR-4324 | ||||
| Sequence (5' -> 3') (72 nts) |
CGGCCCCUUUGUUAAGGGUCUCAGCUCCAGGGAACUUUAAAACCCUGAGACCCUAACCUUAAAGGUGCUGCA | ||||
| MFE | -28.00 kcal/mol | ||||
| first miRBase version | 15.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-4324 |
||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Goff et al. | PLoS ONE | 2009 | 19784364 | Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors. |