| Accession | MI0015040 |
| Name | ppy-mir-542 |
| similar to following miRCarta precursors | ppy-463-136.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
X:134,000,586-134,000,681 (-) |
| miRNA | ppy-miR-542-5p |
| miRNA | ppy-miR-542-3p |
| Sequence (5' -> 3') (96 nts) |
CAGAUCUCAGACAUCUCGGGGAUCAUCAUGUCACGAGAUACCAGUGUGCACUUGUGACAGAUUGAUAACUGAAAGGUCUGGGAGCCACUCAUCUUC |
| MFE | -34.90 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (6 precursors) |
ppy-mir-450b
ppy-mir-450a-1 ppy-mir-450a-2 ppy-mir-542 ppy-mir-503 ppy-mir-424 |
| Family | mir-542 (MIPF0000185) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |