Accession | MI0015027 |
Name | ppy-mir-521-1 |
similar to following miRCarta precursors | ppy-974.3 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
19:55,526,919-55,527,005 (+) |
miRNA | ppy-miR-521 |
Sequence (5' -> 3') (87 nts) |
UCUCAUGCUGUGACCCUCCAAAGGGAAGAACUUUCUGUUGUCUAAAAGAAAAGAACGCACUUCCCUUUAGAGUGUUACCGUGUGAGA |
MFE | -35.10 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (7 precursors) |
ppy-mir-520h
ppy-mir-521-3 ppy-mir-521-1 ppy-mir-522 ppy-mir-527 ppy-mir-516a-3 ppy-mir-518a-3 |
Family | mir-515 (MIPF0000020) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |