Accession | MI0015002 |
Name | ppy-mir-516b-2 |
similar to following miRCarta precursors | ppy-30454.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
19:55,501,004-55,501,095 (+) |
miRNA | ppy-miR-516b |
Sequence (5' -> 3') (92 nts) |
UCUCAUGAGUGUGACCAUCUGGAGGUAAGAAGCACUUUUUGUUUUGUGAAAGAAAAGAAAGUGCUUCCUUUCAGAGGGAUUACUCUUUGAGA |
MFE | -39.00 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (8 precursors) |
ppy-mir-520d
ppy-mir-517c-2 ppy-mir-520g ppy-mir-517c-3 ppy-mir-520g ppy-mir-516b-2 ppy-mir-518g ppy-mir-1283b |
Family | mir-515 (MIPF0000020) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |