Accession | MI0014980 |
Name | ppy-mir-507 |
similar to following miRCarta precursors | ppy-1020.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
X:147,116,183-147,116,272 (-) |
miRNA | ppy-miR-507 |
Sequence (5' -> 3') (90 nts) |
GUGCUGUGUGUAGUGCUUCACUUCAAGAAGUGCCAUGCAUGUGUCUAGAAAUAUGUUUUGCACCUUUUGGAGUGAAAUAAUGCACAACAG |
MFE | -35.90 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (4 precursors) |
ppy-mir-513a-2
ppy-mir-506 ppy-mir-507 ppy-mir-508 |
Family | mir-506 (MIPF0000130) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |