Accession | MI0014975 |
Name | ppy-mir-502 |
similar to following miRCarta precursors | ppy-29004-236.1 |
Organism | Pongo abelii |
miRNA | ppy-miR-502-5p |
miRNA | ppy-miR-502-3p |
Sequence (5' -> 3') (86 nts) |
UGCUCCCCCUCUCUAAUCCUUGCUAUCUGGGUGCUAGUGCUGUCUCAAUGCAAUGCACCUGGGCAAGGAUUCAGAGAGGGGGAGCU |
MFE | -57.00 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Family | mir-500 (MIPF0000139) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |