| Accession | MI0014973 |
| Name | ppy-mir-500 |
| similar to following miRCarta precursors | ppy-345.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
X:50,541,281-50,541,364 (+) |
| miRNA | ppy-miR-500 |
| Sequence (5' -> 3') (84 nts) |
GCUCCCCCUCUCUAAUCCUUGCUACCUGGGUGAGAGUGCUGUCUGAAUGCAAUGCACCUGGGCAAGGAUUCUGAGAGCGAGAGC |
| MFE | -36.60 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (6 precursors) |
ppy-mir-532
ppy-mir-188 ppy-mir-500 ppy-mir-362 ppy-mir-660 ppy-mir-501 |
| Family | mir-500 (MIPF0000139) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |