| Accession | MI0014953 |
| Name | ppy-mir-452 |
| similar to following miRCarta precursors | ppy-188.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
X:152,093,485-152,093,569 (-) |
| miRNA | ppy-miR-452 |
| Sequence (5' -> 3') (85 nts) |
GCUAAGCACUUACAACUGUUUGCAGAGGAAACUGAGACUUUGUAACUAUGUCUCAGUCUCAUCUGCAAAGAAGUAAGUGCUUUGC |
| MFE | -40.40 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (2 precursors) |
ppy-mir-224
ppy-mir-452 |
| Family | mir-452 (MIPF0000287) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |