Accession | MI0014944 |
Name | ppy-mir-432 |
similar to following miRCarta precursors | ppy-327.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
14:102,429,866-102,429,959 (+) |
miRNA | ppy-miR-432 |
Sequence (5' -> 3') (94 nts) |
UGACUCCUCCAGGUCUUGGAGUAGGUCAUUGGGUGGAUCCUCUAUUUCCUUACGUGGGCCACUGGAUGGCUCCUCCAUGUCUUGGAGUAGAUCA |
MFE | -41.00 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (5 precursors) |
ppy-mir-431
ppy-mir-433 ppy-mir-127 ppy-mir-432 ppy-mir-136 |
Family | mir-432 (MIPF0000211) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |