Accession | MI0014914 |
Name | ppy-mir-369 |
similar to following miRCarta precursors | ppy-442-393.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
14:102,628,320-102,628,389 (+) |
miRNA | ppy-miR-369-5p |
miRNA | ppy-miR-369-3p |
Sequence (5' -> 3') (70 nts) |
UUGAAGGGAGAUCGACCGUGUUAUAUUCGCUUUAUUGACUUCGAAUAAUACAUGGUUGAUCUUUUCUCAG |
MFE | -28.10 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (10 precursors) |
ppy-mir-453
ppy-mir-154 ppy-mir-496 ppy-mir-377 ppy-mir-541 ppy-mir-409 ppy-mir-412 ppy-mir-369 ppy-mir-410 ppy-mir-656 |
Family | mir-154 (MIPF0000018) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |