Accession | MI0014913 |
Name | ppy-mir-367 |
similar to following miRCarta precursors | ppy-24446.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
4:117,393,857-117,393,924 (-) |
miRNA | ppy-miR-367 |
Sequence (5' -> 3') (68 nts) |
CCAUUACUGUUGCUAAUAUGCAACUCUGUUUAAUAUAAAUUGGAAUUGCACUUUAGCAAUGGUGAUGG |
MFE | -29.10 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (4 precursors) |
ppy-mir-367 ppy-mir-302d ppy-mir-302c ppy-mir-302b |
Family | mir-367 (MIPF0000162) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |