| Accession | MI0014873 |
| Name | ppy-mir-222 |
| similar to following miRCarta precursors | ppy-140.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
X:46,471,641-46,471,750 (-) |
| miRNA | ppy-miR-222 |
| Sequence (5' -> 3') (110 nts) |
GCUGCUGGAAGGUGUAGGUACCCUCAAUGGCUCAGUAGCCAGUGUAGAUCCUGUCUUUCGUAAUCAGCAGCUACAUCUGGCUACUGGGUCUCUGAUGGCAUCUUCUAGCU |
| MFE | -53.80 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (2 precursors) |
ppy-mir-221
ppy-mir-222 |
| Family | mir-221 (MIPF0000051) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |