Accession | MI0014843 |
Name | ppy-mir-155 |
similar to following miRCarta precursors | ppy-109.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
21:26,044,414-26,044,478 (+) |
miRNA | ppy-miR-155 |
Sequence (5' -> 3') (65 nts) |
CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUACCUCCAACUGACUCCUACAUGUUAGCAUUAACAG |
MFE | -30.00 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (1 precursors) |
ppy-mir-155 |
Family | mir-155 (MIPF0000157) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |