| Accession | MI0014830 |
| Name | ppy-mir-138-2 |
| similar to following miRCarta precursors | ppy-509.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
16:44,110,836-44,110,919 (+) |
| miRNA | ppy-miR-138 |
| Sequence (5' -> 3') (84 nts) |
CGUUGCUGCAGCUGGUGUUGUGAAUCAGGCCGACGAGCAGCGCAUCCUCUUACCCGGCUAUUUCACGACACCAGGGUUGCAUCA |
| MFE | -34.00 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (1 precursors) |
ppy-mir-138-2 |
| Family | mir-138 (MIPF0000075) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |