| Accession | MI0014826 |
| Name | ppy-mir-133b |
| similar to following miRCarta precursors | ppy-629.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
6:52,486,818-52,486,936 (+) |
| miRNA | ppy-miR-133b |
| Sequence (5' -> 3') (119 nts) |
CCUCAGAAGAAAGAUGCCCCCUGCUCUGGCUGGUCAAACGGAACCAAGUCCGUCUUCCUGAGAGGUUUGGUCCCCUUCAACCAGCUACAGCAGGGCUGGCAAUGCCAAGUACUUGGAGA |
| MFE | -48.60 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (2 precursors) |
ppy-mir-206
ppy-mir-133b |
| Family | mir-133 (MIPF0000029) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |