Accession | MI0014825 |
Name | ppy-mir-133c |
similar to following miRCarta precursors | ppy-320.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Locations |
20:60,896,506-60,896,607 (+) 20_random:4,561,056-4,561,157 (+) |
miRNA | ppy-miR-133c |
Sequence (5' -> 3') (102 nts) |
GGGAGCCAAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGACUGUCCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGUGCAUUGAUGGCGCCG |
MFE | -47.50 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (1 precursors) |
ppy-mir-133c |
Family | mir-133 (MIPF0000029) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |