| Accession | MI0014822 |
| Name | ppy-mir-130a |
| similar to following miRCarta precursors | ppy-139.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
11:19,239,577-19,239,665 (-) |
| miRNA | ppy-miR-130a |
| Sequence (5' -> 3') (89 nts) |
UGCUGCUGGCCAGAGCUCUUUUCACAUUGUGCUACUGUCUGCACCUGUCACUAGCAGUGCAAUGUUAAAAGGGCAUUGGCCGUGUAGUG |
| MFE | -42.20 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (1 precursors) |
ppy-mir-130a |
| Family | mir-130 (MIPF0000034) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |