| Accession | MI0014801 |
| Name | ppy-mir-29c |
| similar to following miRCarta precursors | ppy-51.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
1:42,328,128-42,328,215 (+) |
| miRNA | ppy-miR-29c |
| Sequence (5' -> 3') (88 nts) |
AUCUCUUACACAGGCUGACCGAUUUCUCCUGGUGUUCAGAGUCUGUUUUUGUCUAGCACCAUUUGAAAUCGGUUAUGAUGUAGGGGGA |
| MFE | -34.80 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (2 precursors) |
ppy-mir-29b-2
ppy-mir-29c |
| Family | mir-29 (MIPF0000009) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |