Accession | MI0014796 |
Name | ppy-mir-18b |
similar to following miRCarta precursors | ppy-542.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
X:133,612,966-133,613,036 (-) |
miRNA | ppy-miR-18b |
Sequence (5' -> 3') (71 nts) |
UGUGUUAAGGUGCAUCUAGUGCAGUUAGUGAAGCAGCUUAGAAUCUACUGCCCUAAAUGCCCCUUCUGGCA |
MFE | -18.90 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (6 precursors) |
ppy-mir-363
ppy-mir-92-2 ppy-mir-19b-2 ppy-mir-20b ppy-mir-18b ppy-mir-106a |
Family | mir-17 (MIPF0000001) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |