| Accession | MI0014778 |
| Name | ppy-mir-1-1 |
| similar to following miRCarta precursors | ppy-310.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
20:60,885,111-60,885,181 (+) |
| miRNA | ppy-miR-1 |
| Sequence (5' -> 3') (71 nts) |
UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA |
| MFE | -29.10 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (1 precursors) |
ppy-mir-1-1 |
| Family | mir-1 (MIPF0000038) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |