Precursor miRBase

hsa-mir-514b (MI0014251)

Accession MI0014251
Name hsa-mir-514b
similar to following miRCarta precursors hsa-963-1141.1
Organism Homo sapiens
Genome GRCh38.p10
Location chrX:147,250,151-147,250,230 (-)
miRNA hsa-miR-514b-5p
miRNA hsa-miR-514b-3p
Sequence (5' -> 3')
(80 nts)
CAUGUGGUACUCUUCUCAAGAGGGAGGCAAUCAUGUGUAAUUAGAUAUGAUUGACACCUCUGUGAGUGGAGUAACACAUG
MFE -38.60 kcal/mol
first miRBase version 15.0
last miRBase version 21.0
Clusters (10 kb)
(3 precursors)
hsa-mir-514b
hsa-mir-509-2
hsa-mir-509-3
Family mir-506 (MIPF0000130)
Experiments
experiment Pubmed link
Illumina 20300190 21199797 20459774
External DBs
Gene symbol MIR514B
NCBI Gene 100422847

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Witten et al. BMC Biol. 2010 20459774 Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls.
2 Creighton et al. PLoS ONE 2010 20224791 Discovery of novel microRNAs in female reproductive tract using next generation sequencing.
3 Stark et al. PLoS ONE 2010 20300190 Characterization of the Melanoma miRNAome by Deep Sequencing.
4 Persson et al. Cancer Res. 2011 21199797 Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene.