| Accession | MI0014182 | ||||||
| Name | hsa-mir-3154 | ||||||
| similar to following miRCarta precursors | hsa-1287.1 | ||||||
| Organism | Homo sapiens | ||||||
| Genome | GRCh38.p10 | ||||||
| Location |
chr9:128,244,947-128,245,030 (-) |
||||||
| miRNA | hsa-miR-3154 | ||||||
| Sequence (5' -> 3') (84 nts) |
GGCCCCUCCUUCUCAGCCCCAGCUCCCGCUCACCCCUGCCACGUCAAAGGAGGCAGAAGGGGAGUUGGGAGCAGAGAGGGGACC | ||||||
| MFE | -44.00 kcal/mol | ||||||
| first miRBase version | 15.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-199b
hsa-mir-3154 |
||||||
| Family | mir-3154 (MIPF0001387) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Genome Res. | 2006 | 16954537 | Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. |
| 2 | Goff et al. | PLoS ONE | 2009 | 19784364 | Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors. |
| 3 | Stark et al. | PLoS ONE | 2010 | 20300190 | Characterization of the Melanoma miRNAome by Deep Sequencing. |
| 4 | Schotte et al. | Leukemia | 2011 | 21606961 | Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia. |
| 5 | Dannemann et al. | Genome Biol Evol | 2012 | 22454130 | Transcription factors are targeted by differentially expressed miRNAs in primates. |