Precursor miRBase

hsa-mir-3154 (MI0014182)

Accession MI0014182
Name hsa-mir-3154
similar to following miRCarta precursors hsa-1287.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr9:128,244,947-128,245,030 (-)
miRNA hsa-miR-3154
Sequence (5' -> 3')
(84 nts)
GGCCCCUCCUUCUCAGCCCCAGCUCCCGCUCACCCCUGCCACGUCAAAGGAGGCAGAAGGGGAGUUGGGAGCAGAGAGGGGACC
MFE -44.00 kcal/mol
first miRBase version 15.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
hsa-mir-199b
hsa-mir-3154
Family mir-3154 (MIPF0001387)
Experiments
experiment Pubmed link
Illumina 20300190 21606961 22454130
SOLiD 19784364
External DBs
Gene symbol MIR3154
NCBI Gene 100422893

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Berezikov et al. Genome Res. 2006 16954537 Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis.
2 Goff et al. PLoS ONE 2009 19784364 Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors.
3 Stark et al. PLoS ONE 2010 20300190 Characterization of the Melanoma miRNAome by Deep Sequencing.
4 Schotte et al. Leukemia 2011 21606961 Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia.
5 Dannemann et al. Genome Biol Evol 2012 22454130 Transcription factors are targeted by differentially expressed miRNAs in primates.