| Accession | MI0014157 | ||||
| Name | hsa-mir-466 | ||||
| similar to following miRCarta precursors | hsa-1655.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr3:31,161,704-31,161,787 (-) |
||||
| miRNA | hsa-miR-466 | ||||
| Sequence (5' -> 3') (84 nts) |
GUGUGUGUAUAUGUGUGUUGCAUGUGUGUAUAUGUGUGUAUAUAUGUACACAUACACAUACACGCAACACACAUAUAUACAUGC | ||||
| MFE | -48.90 kcal/mol | ||||
| first miRBase version | 15.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-466 |
||||
| Family | mir-467 (MIPF0000316) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Stark et al. | PLoS ONE | 2010 | 20300190 | Characterization of the Melanoma miRNAome by Deep Sequencing. |
| 2 | Persson et al. | Cancer Res. | 2011 | 21199797 | Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. |