| Accession | MI0014122 | ||||
| Name | oar-mir-133 | ||||
| similar to following miRCarta precursors | oar-26270.1 | ||||
| Organism | Ovis aries | ||||
| Genome | Oar_v3.1 | ||||
| Location |
chr13:54,047,670-54,047,763 (-) |
||||
| miRNA | oar-miR-133 | ||||
| Sequence (5' -> 3') (94 nts) |
GGGACCGAAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCAACUGUUCGAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGCGCAUUGAU | ||||
| MFE | -34.00 kcal/mol | ||||
| first miRBase version | 20.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
oar-mir-133 |
||||
| Family | mir-133 (MIPF0000029) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sheng et al. | Mol. Biol. Rep. | 2011 | 20140706 | Characterization of microRNAs from sheep (Ovis aries) using computational and experimental analyses. |