| Accession | MI0014116 | ||||
| Name | oar-mir-21 | ||||
| similar to following miRCarta precursors | oar-1.1 | ||||
| Organism | Ovis aries | ||||
| Genome | Oar_v3.1 | ||||
| Location |
chr11:10,358,524-10,358,595 (+) |
||||
| miRNA | oar-miR-21 | ||||
| Sequence (5' -> 3') (72 nts) |
UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACAGCAGUCGAUGGGCUGUCUGACA | ||||
| MFE | -34.60 kcal/mol | ||||
| first miRBase version | 20.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
oar-mir-21 |
||||
| Family | mir-21 (MIPF0000060) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sheng et al. | Mol. Biol. Rep. | 2011 | 20140706 | Characterization of microRNAs from sheep (Ovis aries) using computational and experimental analyses. |
| 2 | Galio et al. | Physiol. Genomics | 2013 | 23269700 | MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200. |