| Accession | MI0013505 | ||||
| Name | aae-let-7 | ||||
| similar to following miRCarta precursors | aae-40880.1 | ||||
| potential naming conflicts with | aae-let-7 (MIMAT0014299) | ||||
| Organism | Aedes aegypti | ||||
| Genome | AaegL1 | ||||
| Location |
supercont1.43:1,156,326-1,156,396 (+) |
||||
| miRNA | aae-let-7 | ||||
| Sequence (5' -> 3') (71 nts) |
CACGUUGAGGUAGUUGGUUGUAUAGUAGUGACUGAUUAAAUAUCUGCUAUGCAAUCUGCUAGCUUGUCGUG | ||||
| MFE | -29.40 kcal/mol | ||||
| first miRBase version | 15.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
aae-let-7 aae-mir-125 |
||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Li et al. | BMC Genomics | 2009 | 19961592 | Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs. |