| Accession | MI0013482 | ||||||
| Name | aae-mir-133 | ||||||
| similar to following miRCarta precursors | aae-26270.1 | ||||||
| Organism | Aedes aegypti | ||||||
| Genome | AaegL1 | ||||||
| Location |
supercont1.778:350,289-350,407 (-) |
||||||
| miRNA | aae-miR-133 | ||||||
| Sequence (5' -> 3') (119 nts) |
CUCGGAAUCGCUGAAUAUAGCUGGUUGACUUCGGGUCAAAUCGUCAAAUAUUUGCAAAGAUAUUUCCUCAGUGAAAUCAUUUGGUCCCCUUCAACCAGCUGUAGCAGUGAUGCAUUACA | ||||||
| MFE | -39.80 kcal/mol | ||||||
| first miRBase version | 15.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (1 precursors) |
aae-mir-133 |
||||||
| Family | mir-133 (MIPF0000029) | ||||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Li et al. | BMC Genomics | 2009 | 19961592 | Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs. |
| 2 | Skalsky et al. | BMC Genomics | 2010 | 20167119 | Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus. |