| Accession | MI0013433 | ||||||
| Name | aae-mir-184 | ||||||
| similar to following miRCarta precursors | aae-38259.1 | ||||||
| Organism | Aedes aegypti | ||||||
| Genome | AaegL1 | ||||||
| Location |
supercont1.496:143,366-143,453 (-) |
||||||
| miRNA | aae-miR-184 | ||||||
| Sequence (5' -> 3') (88 nts) |
CCGGUGUAUUCGUACCCUUAUCAUUCUUGCGCCCCGUGUUAUAUUGUUGGCGACUGGACGGAGAACUGAUAAGGGCCCGGGUCACCUU | ||||||
| MFE | -35.60 kcal/mol | ||||||
| first miRBase version | 15.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (1 precursors) |
aae-mir-184 |
||||||
| Family | mir-184 (MIPF0000059) | ||||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Li et al. | BMC Genomics | 2009 | 19961592 | Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs. |
| 2 | Skalsky et al. | BMC Genomics | 2010 | 20167119 | Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus. |