Precursor miRBase

ssc-mir-574 (MI0013161)

Accession MI0013161
Name ssc-mir-574
similar to following miRCarta precursors ssc-149.1
Organism Sus scrofa
Genome Sscrofa10.2
Location chr8:31,672,459-31,672,538 (+)
miRNA ssc-miR-574
Sequence (5' -> 3')
(80 nts)
UGGGUGCGGGCGUGUGAGUGUGUGUGUGUGAGUGUGUGUCGCUCCGGGUCCACGCUCAUGCACACACCCACACGCCCGCA
MFE -53.90 kcal/mol
first miRBase version 15.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
ssc-mir-574
Family mir-574 (MIPF0000419)
Experiments
experiment Pubmed link
Illumina 21312241 24499489 19917043
cloned 20180025
External DBs
Gene symbol MIR574
NCBI Gene 100498746

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Cho et al. Mol. Biol. Rep. 2010 20180025 Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue.
2 Nielsen et al. Anim. Genet. 2010 19917043 MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing.
3 Li et al. J. Cell. Biochem. 2011 21312241 MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing.
4 Chen et al. BMC Genomics 2014 24499489 Exploration of microRNAs in porcine milk exosomes.