Accession | MI0013087 | ||||||
Name | ssc-let-7g | ||||||
similar to following miRCarta precursors | ssc-58.1 | ||||||
potential naming conflicts with | ssc-let-7g (MIMAT0013867) | ||||||
Organism | Sus scrofa | ||||||
Genome | Sscrofa10.2 | ||||||
Location |
chr13:37,599,004-37,599,083 (+) |
||||||
miRNA | ssc-let-7g | ||||||
Sequence (5' -> 3') (80 nts) |
GGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCACUGCCUUG | ||||||
MFE | -33.80 kcal/mol | ||||||
first miRBase version | 15.0 | ||||||
last miRBase version | 21.0 | ||||||
Clusters (10 kb) (1 precursors) |
ssc-let-7g |
||||||
Family | let-7 (MIPF0000002) | ||||||
Experiments |
|
||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Nielsen et al. | Anim. Genet. | 2010 | 19917043 | MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing. |
2 | Cho et al. | Mol. Biol. Rep. | 2010 | 20180025 | Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue. |
3 | Li et al. | J. Cell. Biochem. | 2011 | 21312241 | MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing. |
4 | Chen et al. | BMC Genomics | 2014 | 24499489 | Exploration of microRNAs in porcine milk exosomes. |