Precursor miRBase

bta-mir-669 (MI0013053)

Accession MI0013053
Name bta-mir-669
similar to following miRCarta precursors bta-27767.1
Organism Bos taurus
Genome UMD3.1
Location chr16:63,239,568-63,239,631 (-)
miRNA bta-miR-669
Sequence (5' -> 3')
(64 nts)
AGAGUGUGUGGGUGUGUGCAUGUGCGUGUGUGCACAUGCAUAUGUGUGUGGCUAUCUUAGCUGU
MFE -22.00 kcal/mol
first miRBase version 15.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
bta-mir-669
Family mir-467 (MIPF0000316)
Experiments
experiment Pubmed link
cloned 19765282
External DBs
Gene symbol MIR669
NCBI Gene 100498846

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Hossain et al. BMC Genomics 2009 19765282 Identification and characterization of miRNAs expressed in the bovine ovary.