| Accession | MI0013051 | ||||
| Name | bta-mir-193a-2 | ||||
| similar to following miRCarta precursors | bta-27719.1 | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr14:2,272,017-2,272,069 (-) |
||||
| miRNA | bta-miR-193a | ||||
| Sequence (5' -> 3') (53 nts) |
AUGGCUGCCUCACAAGGUUUGGAGCUGUGCCUGGGACUUUGUAGGCCAGUUCA | ||||
| MFE | -18.50 kcal/mol | ||||
| first miRBase version | 15.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
bta-mir-193a-2 |
||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Hossain et al. | BMC Genomics | 2009 | 19765282 | Identification and characterization of miRNAs expressed in the bovine ovary. |