| Accession | MI0012980 | ||||
| Name | eca-mir-542 | ||||
| similar to following miRCarta precursors | eca-25650-136.1 | ||||
| Organism | Equus caballus | ||||
| Genome | Equ Cab 2 | ||||
| Location |
chrX:106,949,741-106,949,826 (-) |
||||
| miRNA | eca-miR-542-5p | ||||
| miRNA | eca-miR-542-3p | ||||
| Sequence (5' -> 3') (86 nts) |
AGGACCUCAGACAUCUCGGGGAUCAUCAUGUCACGAGAUACCACUGUGCACUUGUGACAGAUUGAUAACUGAAAGGUCUGGGAGCC | ||||
| MFE | -35.90 kcal/mol | ||||
| first miRBase version | 14.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
eca-mir-450b
eca-mir-450a eca-mir-450c eca-mir-542 eca-mir-503 eca-mir-424 |
||||
| Family | mir-542 (MIPF0000185) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |