| Accession | MI0012970 | ||||
| Name | eca-mir-501 | ||||
| similar to following miRCarta precursors | eca-29391.1 | ||||
| Organism | Equus caballus | ||||
| Genome | Equ Cab 2 | ||||
| Location |
chrX:40,074,566-40,074,649 (+) |
||||
| miRNA | eca-miR-501-5p | ||||
| Sequence (5' -> 3') (84 nts) |
GCUCUCCCUCUCUCAUCCUUCGUCCCUGGGUGAGAGUGCUUUCCGAAUGCAAUGCACCUGGGCAAGGAUUCCAGAGGGCGAGGC | ||||
| MFE | -36.90 kcal/mol | ||||
| first miRBase version | 14.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (8 precursors) |
eca-mir-532
eca-mir-188 eca-mir-500-1 eca-mir-362 eca-mir-501 eca-mir-500-2 eca-mir-660 eca-mir-502 |
||||
| Family | mir-500 (MIPF0000139) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |