Accession | MI0012969 | ||||
Name | eca-mir-500-2 | ||||
similar to following miRCarta precursors | eca-345.2 | ||||
Organism | Equus caballus | ||||
Genome | Equ Cab 2 | ||||
Location |
chrX:40,075,101-40,075,184 (+) |
||||
miRNA | eca-miR-500 | ||||
Sequence (5' -> 3') (84 nts) |
GCUCCCCCUCUCUAAUCCUUGCUACCUGGGUGAGAGUGCUUUCUGAAUGCAAUGCACCUGGGCAAGGAUUCCGAGAGGGAGAGU | ||||
MFE | -42.70 kcal/mol | ||||
first miRBase version | 14.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (8 precursors) |
eca-mir-532
eca-mir-188 eca-mir-500-1 eca-mir-362 eca-mir-501 eca-mir-500-2 eca-mir-660 eca-mir-502 |
||||
Family | mir-500 (MIPF0000139) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |