| Accession | MI0012860 | ||||
| Name | eca-let-7f | ||||
| similar to following miRCarta precursors | eca-20.1 | ||||
| potential naming conflicts with | eca-let-7f (MIMAT0013111) | ||||
| Organism | Equus caballus | ||||
| Genome | Equ Cab 2 | ||||
| Location |
chr23:54,150,758-54,150,844 (-) |
||||
| miRNA | eca-let-7f | ||||
| Sequence (5' -> 3') (87 nts) |
UCGGAGUGAGGUAGUAGAUUGUAUAGUUGUGGGGUAGUGAUUUUACCCUGUUCAGGAGAUAACUAUACAAUCUAUUGCCUUCCCUGA | ||||
| MFE | -40.00 kcal/mol | ||||
| first miRBase version | 14.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
eca-let-7d
eca-let-7f |
||||
| Family | let-7 (MIPF0000002) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |