Precursor miRBase

bta-mir-219-2 (MI0012210)

Accession MI0012210
Name bta-mir-219-2
potential naming conflicts with bta-mir-219-2 (MI0025539)
entry is obsolete
MI0012210 -> MI0009781
Two previously annotated mir-219 entries map to the same locus in the UMD3.1 genome assembly, and so are merged.
Organism Bos taurus
Sequence (5' -> 3')
(88 nts)
GAGCUUCGCCACUGAUUGUCCAAACGCAAUUCUUGUACGAGUCUGCGGCCAACCGAGAAUUGUGGCUGGACAUCUGUGGCUGAGCUCU
MFE -45.40 kcal/mol
first miRBase version 15.0
last miRBase version 18.0
Experiments
experiment Pubmed link
cloned 19758457

Predicted Structure