| Accession | MI0010683 | ||||||
| Name | ssc-mir-450a | ||||||
| similar to following miRCarta precursors | ssc-34498.1 | ||||||
| Organism | Sus scrofa | ||||||
| miRNA | ssc-miR-450a | ||||||
| Sequence (5' -> 3') (106 nts) |
GUCUGUCAAAGAAAGAUGCUAAACUGGUUUUGCGAUGUGUUCCUAAUAUGCAGUAUAAAUAUAUUGGGAGCAUUUUGCAUGCAUGGUUUUGUAUCACUAUACAGAU | ||||||
| MFE | -36.10 kcal/mol | ||||||
| first miRBase version | 13.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Family | mir-450 (MIPF0000128) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Reddy et al. | BMC Genomics | 2009 | 19196471 | Cloning, characterization and expression analysis of porcine microRNAs. |
| 2 | Nielsen et al. | Anim. Genet. | 2010 | 19917043 | MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing. |
| 3 | Li et al. | J. Cell. Biochem. | 2011 | 21312241 | MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing. |