Accession | MI0010681 | ||||||
Name | ssc-mir-133a-1 | ||||||
similar to following miRCarta precursors | ssc-26061-26270.1 | ||||||
Organism | Sus scrofa | ||||||
Genome | Sscrofa10.2 | ||||||
Location |
chr17:69,274,653-69,274,755 (-) |
||||||
miRNA | ssc-miR-133a-5p | ||||||
miRNA | ssc-miR-133a-3p | ||||||
Sequence (5' -> 3') (103 nts) |
CGGGACCCAAAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCAACUGUUGAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGCGCAUUGACAGCGCCG | ||||||
MFE | -36.90 kcal/mol | ||||||
first miRBase version | 13.0 | ||||||
last miRBase version | 21.0 | ||||||
Clusters (10 kb) (1 precursors) |
ssc-mir-133a-1 |
||||||
Family | mir-133 (MIPF0000029) | ||||||
Experiments |
|
||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Reddy et al. | BMC Genomics | 2009 | 19196471 | Cloning, characterization and expression analysis of porcine microRNAs. |
2 | Cho et al. | Mol. Biol. Rep. | 2010 | 20180025 | Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue. |
3 | Nielsen et al. | Anim. Genet. | 2010 | 19917043 | MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing. |
4 | Li et al. | J. Cell. Biochem. | 2011 | 21312241 | MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing. |
5 | Chen et al. | BMC Genomics | 2014 | 24499489 | Exploration of microRNAs in porcine milk exosomes. |