| Accession | MI0010518 | ||||
| Name | bfl-mir-125b | ||||
| similar to following miRCarta precursors | bfl-40041.1 | ||||
| Organism | Branchiostoma floridae | ||||
| Genome | JGI2.0 | ||||
| Location |
Bf_V2_28:2,707,563-2,707,644 (-) |
||||
| miRNA | bfl-miR-125b | ||||
| Sequence (5' -> 3') (82 nts) |
GUGGAGGGCGUAUGUCACCCAGCUCCCAAGAUCCUAACCUGUGAGCCAUGGACAUCACAAGUUAGGGUCUCAGGGAAUGGGG | ||||
| MFE | -34.50 kcal/mol | ||||
| first miRBase version | 13.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
bfl-mir-100
bfl-let-7a-1 bfl-let-7b bfl-mir-125a bfl-mir-125b bfl-let-7a-2 |
||||
| Family | mir-10 (MIPF0000033) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Dai et al. | Evol. Dev. | 2009 | 19196332 | Characterization of microRNAs in cephalochordates reveals a correlation between microRNA repertoire homology and morphological similarity in chordate evolution. |