Accession | MI0010485 | ||||
Name | bta-mir-181b-1 | ||||
similar to following miRCarta precursors | bta-73.1 | ||||
Organism | Bos taurus | ||||
Genome | UMD3.1 | ||||
Location |
chr16:79,685,760-79,685,869 (-) |
||||
miRNA | bta-miR-181b | ||||
Sequence (5' -> 3') (110 nts) |
CUUGGGCAGAGGUUCUUUCUUAAAAGGUCACAAUCAACAUUCAUUGCUGUCGGUGGGUUGAACUGUGUGGACAAGCUCACUGAACAAUGAGUGCAACUGUGGCCCCGCAU | ||||
MFE | -35.40 kcal/mol | ||||
first miRBase version | 13.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
bta-mir-181b-1 bta-mir-181a-1 |
||||
Family | mir-181 (MIPF0000007) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
2 | Strozzi et al. | Anim. Genet. | 2009 | 18945293 | Annotation of 390 bovine miRNA genes by sequence similarity with other species. |
3 | Jin et al. | BMC Mol. Biol. | 2009 | 19758457 | Characterization of bovine miRNAs by sequencing and bioinformatics analysis. |