| Accession | MI0009937 | ||||
| Name | mmu-mir-1947 | ||||
| similar to following miRCarta precursors | mmu-25447-25446.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chr16:33,105,361-33,105,445 (+) |
||||
| miRNA | mmu-miR-1947-5p | ||||
| miRNA | mmu-miR-1947-3p | ||||
| Sequence (5' -> 3') (85 nts) |
GAACAAGGUGGUGGAGGACGAGCUAGCUGAGUGCUGCAGACACUCUAAGAGCACUGAGCUAGCUCUCCCUCCAUGCCCUGCUCAA | ||||
| MFE | -46.30 kcal/mol | ||||
| first miRBase version | 13.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
mmu-mir-1947 |
||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Kuchenbauer et al. | Genome Res. | 2008 | 18849523 | In-depth characterization of the microRNA transcriptome in a leukemia progression model. |
| 2 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |