| Accession | MI0009894 | ||||
| Name | bta-mir-760 | ||||
| similar to following miRCarta precursors | bta-3174-448.1 | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr3:49,797,090-49,797,206 (-) |
||||
| miRNA | bta-miR-760-5p | ||||
| miRNA | bta-miR-760-3p | ||||
| Sequence (5' -> 3') (117 nts) |
GGAGGAUGCUGCAGCGUGGGGCGCGUCGCCCCCCUCAGUCCACCAGAGCCCGGAUACCUUAGAAAUUCGGCUCUGGGUCUGUGGGGAGCGAAAUGCAACCCAAACUCCAUUUUGCCG | ||||
| MFE | -51.60 kcal/mol | ||||
| first miRBase version | 13.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
bta-mir-760 |
||||
| Family | mir-760 (MIPF0000395) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Artzi et al. | BMC Bioinformatics | 2008 | 18215311 | miRNAminer: a tool for homologous microRNA gene search. |
| 2 | Strozzi et al. | Anim. Genet. | 2009 | 18945293 | Annotation of 390 bovine miRNA genes by sequence similarity with other species. |
| 3 | Guduric-Fuchs et al. | J. Cell. Biochem. | 2012 | 22298343 | Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells. |