| Accession | MI0009861 | ||||
| Name | bta-mir-544b-2 | ||||
| similar to following miRCarta precursors | bta-27942.1 | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr24:35,602,255-35,602,346 (-) |
||||
| miRNA | bta-miR-544b | ||||
| Sequence (5' -> 3') (92 nts) |
AUCACCUGGGGAUCUUGUUAAAUGAGAUUCUGGUUCGGUAGGAAUGGGGCCUGAGAUUCUGCAUUUCUAACAAGUUCUCAGGUGAUGCCACU | ||||
| MFE | -38.70 kcal/mol | ||||
| first miRBase version | 13.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
bta-mir-544b-2 |
||||
| Family | mir-544 (MIPF0000436) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Strozzi et al. | Anim. Genet. | 2009 | 18945293 | Annotation of 390 bovine miRNA genes by sequence similarity with other species. |